-x

The basename of the index for the reference genome. The basename is the name of any of the index files up to but not including the final.1.bt2 / .rev.1.bt2 / etc. bowtie2 looks for the specified index first in the current directory, then in the directory specified in theBOWTIE2_INDEXES environment variable.

-1

Comma-separated list of files containing mate 1s (filename usually includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in . Reads may be a mix of different lengths. If- is specified, bowtie2 will read the mate 1s from the "standard in" or "stdin" filehandle.

-2

Comma-separated list of files containing mate 2s (filename usually includes _2), e.g. -2 flyA_2.fq,flyB_2.fq. Sequences specified with this option must correspond file-for-file and read-for-read with those specified in . Reads may be a mix of different lengths. If- is specified, bowtie2 will read the mate 2s from the "standard in" or "stdin" filehandle.

-U

Comma-separated list of files containing unpaired reads to be aligned, e.g. lane1.fq,lane2.fq,lane3.fq,lane4.fq. Reads may be a mix of different lengths. If - is specified, bowtie2 gets the reads from the "standard in" or "stdin" filehandle.

-S

File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console).

-q

Reads (specified with , , ) are FASTQ files. FASTQ files usually have extension .fq or .fastq. FASTQ is the default format. See also: --solexa-quals and --int-quals.

--qseq

Reads (specified with , , ) are QSEQ files. QSEQ files usually end in _qseq.txt. See also: --solexa-quals and--int-quals.

-f

Reads (specified with , , ) are FASTA files. FASTA files usually have extension .fa, .fasta, .mfa, .fna or similar. FASTA files do not have a way of specifying quality values, so when -f is set, the result is as if --ignore-quals is also set.

-r

Reads (specified with , , ) are files with one input sequence per line, without any other information (no read names, no qualities). When -r is set, the result is as if --ignore-quals is also set.

-c

The read sequences are given on command line. I.e. , and  are comma-separated lists of reads rather than lists of read files. There is no way to specify read names or qualities, so -c also implies --ignore-quals.

-s/--skip

Skip (i.e. do not align) the first  reads or pairs in the input.

-u/--qupto

Align the first  reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop. Default: no limit.

-5/--trim5

Trim  bases from 5' (left) end of each read before alignment (default: 0).

-3/--trim3

Trim  bases from 3' (right) end of each read before alignment (default: 0).

--phred33

Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines.

--phred64

Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding.

--solexa-quals

Convert input qualities from Solexa (which can be negative) toPhred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3). Default: off.

--int-quals

Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified. Default: off.

--very-fast

Same as: -D 5 -R 1 -N 0 -L 22 -i S,0,2.50

--fast

Same as: -D 10 -R 2 -N 0 -L 22 -i S,0,2.50

--sensitive

Same as: -D 15 -R 2 -L 22 -i S,1,1.15 (default in --end-to-end mode)

--very-sensitive

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

--very-fast-local

Same as: -D 5 -R 1 -N 0 -L 25 -i S,1,2.00

--fast-local

Same as: -D 10 -R 2 -N 0 -L 22 -i S,1,1.75

--sensitive-local

Same as: -D 15 -R 2 -N 0 -L 20 -i S,1,0.75(default in --local mode)

--very-sensitive-local

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

-N

Sets the number of mismatches to allowed in a seed alignment during multiseed alignment. Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity. Default: 0.

-L

Sets the length of the seed substrings to align during multiseed alignment. Smaller values make alignment slower but more senstive. Default: the --sensitive preset is used by default, which sets -L to 20 both in --end-to-end mode and in --local mode.

-i

Sets a function governing the interval between seed substrings to use during multiseed alignment. For instance, if the read has 30 characers, and seed length is 10, and the seed interval is 6, the seeds extracted will be:

Read: TAGCTACGCTCTACGCTATCATGCATAAAC Seed 1 fw: TAGCTACGCT Seed 1 rc: AGCGTAGCTA Seed 2 fw: CGCTCTACGC Seed 2 rc: GCGTAGAGCG Seed 3 fw: ACGCTATCAT Seed 3 rc: ATGATAGCGT Seed 4 fw: TCATGCATAA Seed 4 rc: TTATGCATGA

Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying -i S,1,2.5 sets the interval function f to f(x) = 1 + 2.5 * sqrt(x), where x is the read length. See also: setting function options. If the function returns a result less than 1, it is rounded up to 1. Default: the --sensitive preset is used by default, which sets -i to S,1,1.15 in --end-to-end mode to -i S,1,0.75 in --local mode.

--n-ceil

Sets a function governing the maximum number of ambiguous characters (usually Ns and/or .s) allowed in a read as a function of read length. For instance, specifying -L,0,0.15 sets the N-ceiling function f to f(x) = 0 + 0.15 * x, where x is the read length. See also: setting function options. Reads exceeding this ceiling are filtered out. Default: L,0,0.15.

--dpad

"Pads" dynamic programming problems by  columns on either side to allow gaps. Default: 15.

--gbar

Disallow gaps within  positions of the beginning or end of the read. Default: 4.

--ignore-quals

When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value. I.e. input is treated as though all quality values are high. This is also the default behavior when the input doesn't specify quality values (e.g. in -f, -r, or -c modes).

--nofw/--norc

If --nofw is specified, bowtie2 will not attempt to align unpaired reads to the forward (Watson) reference strand. If --norc is specified, bowtie2 will not attempt to align unpaired reads against the reverse-complement (Crick) reference strand. In paired-end mode, --nofw and --norc pertain to the fragments; i.e. specifying --nofw causes bowtie2 to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default: both strands enabled.

--no-1mm-upfront

By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read before trying themultiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing themultiseed heuristic, like -L and -N. For instance, if the user specifies -N 0 and -L equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as -L and -N. This comes at the expense of speed.

--end-to-end

In this mode, Bowtie 2 requires that the entire read align from one end to the other, without any trimming (or "soft clipping") of characters from either end. The match bonus --ma always equals 0 in this mode, so all alignment scores are less than or equal to 0, and the greatest possible alignment score is 0. This is mutually exclusive with --local. --end-to-end is the default mode.

--local

In this mode, Bowtie 2 does not require that the entire read align from one end to the other. Rather, some characters may be omitted ("soft clipped") from the ends in order to achieve the greatest possible alignment score. The match bonus --ma is used in this mode, and the best possible alignment score is equal to the match bonus (--ma) times the length of the read. Specifying --local and one of the presets (e.g. --local --very-fast) is equivalent to specifying the local version of the preset (--very-fast-local). This is mutually exclusive with --end-to-end. --end-to-end is the default mode.

--ma

Sets the match bonus. In --local mode  is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in --end-to-end mode. Default: 2.

--mp MX,MN

Sets the maximum (MX) and minimum (MN) mismatch penalties, both integers. A number less than or equal to MXand greater than or equal to MN is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an N. If --ignore-quals is specified, the number subtracted quals MX. Otherwise, the number subtracted is MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality value. Default: MX = 6, MN = 2.

--np

Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as N. Default: 1.

--rdg ,

Sets the read gap open () and extend () penalties. A read gap of length N gets a penalty of + N * . Default: 5, 3.

--rfg ,

Sets the reference gap open () and extend () penalties. A reference gap of length N gets a penalty of + N * . Default: 5, 3.

--score-min

Sets a function governing the minimum alignment score needed for an alignment to be considered "valid" (i.e. good enough to report). This is a function of read length. For instance, specifying L,0,-0.6 sets the minimum-score function f to f(x) = 0 + -0.6 * x, where x is the read length. See also: setting function options. The default in --end-to-end mode is L,-0.6,-0.6 and the default in --local mode is G,20,8.

-k

By default, bowtie2 searches for distinct, valid alignments for each read. When it finds a valid alignment, it continues looking for alignments that are nearly as good or better. The best alignment found is reported (randomly selected from among best if tied). Information about the best alignments is used to estimate mapping quality and to set SAM optional fields, such as AS:i and XS:i.

When -k is specified, however, bowtie2 behaves differently. Instead, it searches for at most  distinct, valid alignments for each read. The search terminates when it can't find more distinct valid alignments, or when it finds , whichever happens first. All alignments found are reported in descending order by alignment score. The alignment score for a paired-end alignment equals the sum of the alignment scores of the individual mates. Each reported read or pair alignment beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS field. For reads that have more than  distinct, valid alignments, bowtie2does not gaurantee that the  alignments reported are the best possible in terms of alignment score. -k is mutually exclusive with -a.

Note: Bowtie 2 is not designed with large values for -k in mind, and when aligning reads to long, repetitive genomes large -k can be very, very slow.

-a

Like -k but with no upper limit on number of alignments to search for. -ais mutually exclusive with -k.

Note: Bowtie 2 is not designed with -a mode in mind, and when aligning reads to long, repetitive genomes this mode can be very, very slow.

-D

Up to  consecutive seed extension attempts can "fail" before Bowtie 2 moves on, using the alignments found so far. A seed extension "fails" if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default: 15.

-R

 is the maximum number of times Bowtie 2 will "re-seed" reads with repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default: 2.

-I/--minins

The minimum fragment length for valid paired-end alignments. E.g. if -I 60 is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as -X is also satisfied). A 19-bp gap would not be valid in that case. If trimming options -3 or -5 are also used, the -I constraint is applied with respect to the untrimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.

Default: 0 (essentially imposing no minimum)

-X/--maxins

The maximum fragment length for valid paired-end alignments. E.g. if -X 100 is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as -I is also satisfied). A 61-bp gap would not be valid in that case. If trimming options -3 or -5are also used, the -X constraint is applied with respect to the untrimmed mates, not the trimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will run. This is because larger differences bewteen -I and -X require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient.

Default: 500.

--fr/--rf/--ff

The upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand. E.g., if --fr is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (-I and -X) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. --rf likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. --ff requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented. Default: --fr (appropriate for Illumina's Paired-end Sequencing Assay).

--no-mixed

By default, when bowtie2 cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates. This option disables that behavior.

--no-discordant

By default, bowtie2 looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (--fr/--rf/--ff,-I, -X). This option disables that behavior.

--dovetail

If the mates "dovetail", that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also:Mates can overlap, contain or dovetail each other. Default: mates cannot dovetail in a concordant alignment.

--no-contain

If one mate alignment contains the other, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: a mate can contain the other in a concordant alignment.

--no-overlap

If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: Mates can overlap, contain or dovetail each other. Default: mates can overlap in a concordant alignment.

-t/--time

Print the wall-clock time required to load the index files and align the reads. This is printed to the "standard error" ("stderr") filehandle. Default: off.

--un --un-gz --un-bz2

Write unpaired reads that fail to align to file at . These reads correspond to the SAM records with the FLAGS0x4 bit set and neither the 0x40 nor 0x80 bits set. If --un-gz is specified, output will be gzip compressed. If --un-bz2 is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.

--al --al-gz --al-bz2

Write unpaired reads that align at least once to file at. These reads correspond to the SAM records with the FLAGS 0x4, 0x40, and 0x80 bits unset. If --al-gz is specified, output will be gzip compressed. If --al-bz2 is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.

--un-conc --un-conc-gz --un-conc-bz2

Write paired-end reads that fail to align concordantly to file(s) at . These reads correspond to the SAM records with the FLAGS 0x4 bit set and either the 0x40 or0x80 bit set (depending on whether it's mate #1 or #2)..1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in , the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.

--al-conc --al-conc-gz --al-conc-bz2

Write paired-end reads that align concordantly at least once to file(s) at . These reads correspond to the SAM records with the FLAGS 0x4 bit unset and either the0x40 or 0x80 bit set (depending on whether it's mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in , the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.

--quiet

Print nothing besides alignments and serious errors.

--met-file

Write bowtie2 metrics to file . Having alignment metric can be useful for debugging certain problems, especially performance issues. See also: --met. Default: metrics disabled.

--met-stderr

Write bowtie2 metrics to the "standard error" ("stderr") filehandle. This is not mutually exclusive with --met-file. Having alignment metric can be useful for debugging certain problems, especially performance issues. See also:--met. Default: metrics disabled.

--met

Write a new bowtie2 metrics record every  seconds. Only matters if either --met-stderr or --met-file are specified. Default: 1.

--no-unal

Suppress SAM records for reads that failed to align.

--no-hd

Suppress SAM header lines (starting with @).

--no-sq

Suppress @SQ SAM header lines.

--rg-id

Set the read group ID to . This causes the SAM @RG header line to be printed, with  as the value associated with theID: tag. It also causes the RG:Z: extra field to be attached to each SAM output record, with value set to .

--rg

Add  (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on the @RG header line. Note: in order for the @RG line to appear, --rg-id must also be specified. This is because the IDtag is required by the SAM Spec. Specify --rg multiple times to set multiple fields. See the SAM Spec for details about what fields are legal.

--omit-sec-seq

When printing secondary alignments, Bowtie 2 by default will write out the SEQ and QUAL strings. Specifying this option causes Bowtie 2 to print an asterix in those fields instead.

-o/--offrate

Override the offrate of the index with . If  is greater than the offrate used to build the index, then some row markings are discarded when the index is read into memory. This reduces the memory footprint of the aligner but requires more time to calculate text offsets. must be greater than the value used to build the index.

-p/--threads NTHREADS

Launch NTHREADS parallel search threads (default: 1). Threads will run on separate processors/cores and synchronize when parsing reads and outputting alignments. Searching for alignments is highly parallel, and speedup is close to linear. Increasing -p increases Bowtie 2's memory footprint. E.g. when aligning to a human genome index, increasing -p from 1 to 8 increases the memory footprint by a few hundred megabytes. This option is only available if bowtie is linked with thepthreads library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time).

--reorder

Guarantees that output SAM records are printed in an order corresponding to the order of the reads in the original input file, even when -p is set greater than 1. Specifying --reorder and setting -p greater than 1 causes Bowtie 2 to run somewhat slower and use somewhat more memory then if --reorder were not specified. Has no effect if -p is set to 1, since output order will naturally correspond to input order in that case.

--mm

Use memory-mapped I/O to load the index, rather than typical file I/O. Memory-mapping allows many concurrentbowtie processes on the same computer to share the same memory image of the index (i.e. you pay the memory overhead just once). This facilitates memory-efficient parallelization of bowtie in situations where using -p is not possible or not preferable.

--qc-filter

Filter out reads for which the QSEQ filter field is non-zero. Only has an effect when read format is --qseq. Default: off.

--seed

Use  as the seed for pseudo-random number generator. Default: 0.

--non-deterministic

Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the --seed option. This means that if two reads are identical (same name, same nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s) for both, even if there was ambiguity. When --non-deterministic is specified, Bowtie 2 re-initializes its pseudo-random generator for each read using the current time. This means that Bowtie 2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.

--version

Print version information and quit.

-h/--help

Print usage information and quit.